Plasma concentrations of transforming growth factor beta 1 in non-progressive HIV-1 infection correlates with markers of disease progression.

The human immunodeficiency virus (HIV) infection shows variable rate of disease progression. The underlying biological and molecular mechanisms involved in determining progression of HIV infection are not fully understood. The aims of this study were to determine plasma concentrations of active TGF ß 1, Th1 and Th2 cytokines in patients with non-progressive and those with progressive HIV-1 infection, as well as to determine if there is an association of these cytokines to disease progression. In a cross-sectional study of 61 HIV-1 infected individuals categorized according to disease progression as having non-progressive HIV-1 infection (n=14) and progressive infection (n=47), plasma levels of active TGF ß 1, INF-γ, TNF-α, IL-10, IL-1ß, IL-12p70 and IL-13 were compared with HIV uninfected healthy controls (n=12). Plasma concentration of these cytokines was measured using a highly sensitive luminex200 XMAP assay. Pearson correlation test was used to assess the correlation of cytokines with CD4+ and CD8+ T cells, CD4:CD8 ratio and plasma HIV-1 RNA in the different study groups. Plasma concentrations of TGF ß 1 and IL-10 were significantly decreased while IL-1ß, IL-12p70 and TNF-α were increased in patients with non-progressive HIV-1 infection compared to patients with progressive infection. Plasma levels of TGF ß 1 and IL-10 showed an inverse correlation with CD8+ T cell counts and CD4:CD8 ratios in patients with non-progressive HIV-1 infection, while plasma HIV-1 RNA positively correlated with CD4+ T cell counts. Plasma levels of TNF-α, IL-1ß, IL-12p70 and IL-13 positively correlated with CD4+ T cell counts and inversely correlated with plasma HIV-1 RNA, CD8+ T cell count and CD4:CD8 ratio in patients with non-progressive infection. The correlation of cytokines to the state of T-lymphocyte and plasma HIV-1 RNA found in this study may provide insight into the role of cytokines in both progressive and non-progressive HIV-1 infection. Additionally, these findings may have implications for systemic cytokine-based therapies in HIV-1 infection.

CD4+ T cell counts in initiation of antiretroviral therapy in HIV infected asymptomatic individuals; controversies and inconsistencies.

The primary goal when devising strategies to define the start of therapy in HIV infected individuals is to avoid HIV disease progression and toxicity from antiretroviral therapy (ART). Intermediate goals includes, avoiding resistance by suppressing HIV replication, reducing transmission, limiting spread and diversity of HIV within the body and protecting the immune system from harm. The question of how early or late to start ART and achieve both primary and intermediate goals has dominated HIV research. The distinction between early and late treatment of HIV infection is currently a matter of CD4+ T cells count, a marker of immune status, rather than on viral load, a marker of virus replication. Discussions about respective benefits of early or delayed therapy, as well as the best CD4+ T cell threshold during the course of HIV infection at which ART is initiated remains inconclusive. Guidelines issued by various agencies, provide different initiation recommendations. This can be confusing for clinicians and policy-makers when determining the best time to initiate therapy. Optimizing ART initiation strategies are clearly complex and must be balanced between individual and broader public health needs. This review assesses available data that contributes to the debate on optimal time to initiate therapy in HIV-infected asymptomatic individuals. We also review reports on CD4+ T cell threshold to guide initiation of ART and finally discuss arguments for and against early or late initiation of ART.

Live attenuated malaria vaccine designed to protect through hepatic CD8⁺ T cell immunity.

Our goal is to develop a vaccine that sustainably prevents Plasmodium falciparum (Pf) malaria in ≥80% of recipients. Pf sporozoites (PfSPZ) administered by mosquito bites are the only immunogens shown to induce such protection in humans. Such protection is thought to be mediated by CD8(+) T cells in the liver that secrete interferon-γ (IFN-γ). We report that purified irradiated PfSPZ administered to 80 volunteers by needle inoculation in the skin was safe, but suboptimally immunogenic and protective. Animal studies demonstrated that intravenous immunization was critical for inducing a high frequency of PfSPZ-specific CD8(+), IFN-γ-producing T cells in the liver (nonhuman primates, mice) and conferring protection (mice). Our results suggest that intravenous administration of this vaccine will lead to the prevention of infection with Pf malaria.

Cross-protection between attenuated Plasmodium berghei and P. yoelii sporozoites.

An attenuated Plasmodium falciparum sporozoite (PfSPZ) vaccine is under development, in part, based on studies in mice with P. berghei. We used P. berghei and P. yoelii to study vaccine-induced protection against challenge with a species of parasite different from the immunizing parasite in BALB/c mice. One-hundred percent of mice were protected against homologous challenge. Seventy-nine percent immunized with attenuated P. berghei sporozoite (PbSPZ) (six experiments) were protected against challenge with P. yoelii sporozoite (PySPZ), and 63% immunized with attenuated PySPZ (three experiments) were protected against challenge with PbSPZ. Antibodies in sera of immunized mice only recognized homologous sporozoites and could not have mediated protection against heterologous challenge. Immunization with attenuated PySPZ or PbSPZ induced CD8+ T cell-dependent protection against heterologous challenge. Immunization with attenuated PySPZ induced CD8+ T cell-dependent protection against homologous challenge. However, homologous protection induced by attenuated PbSPZ was not dependent on CD8+ or CD4+ T cells, and depletion of both populations only reduced protection by 36%. Immunization of C57BL/10 mice with PbSPZ induced CD8+ T cell-dependent protection against P. berghei, but no protection against P. yoelii. The cross-protection data in BALB/c mice support testing a human vaccine based on attenuated PfSPZ for its efficacy against P. vivax.

Effect on antibody and T-cell responses of mixing five GMP-produced DNA plasmids and administration with plasmid expressing GM-CSF.

One potential benefit of DNA vaccines is the capacity to elicit antibody and T-cell responses against multiple antigens at the same time by mixing plasmids expressing different proteins. A possible negative effect of such mixing is interference among plasmids regarding immunogenicity. In preparation for a clinical trial, we assessed the immunogenicity of GMP-produced plasmids encoding five Plasmodium falciparum proteins, PfCSP, PfSSP2, PfEXP1, PfLSA1, and PfLSA3, given as a mixture, or alone. The mixture induced higher levels of antibodies against whole parasites than did the individual plasmids, but was associated with a decrease in antibodies to individual P. falciparum proteins. T-cell responses were in general decreased by administration of the mixture. Immune responses to individual plasmids and mixtures were generally higher in inbred mice than in outbreds. In inbred BALB/c and C57BL/6 mice, coadministration of a plasmid expressing murine granulocyte-macrophage colony-stimulating factor (mGM-CSF), increased antibody and T-cell responses, but in outbred CD-1 mice, coadministration of mGM-CSF was associated with a decrease in antibody responses. Such variability in data from studies in different strains of mice underscores the importance of genetic background on immune response and carefully considering the goals of any preclinical studies of vaccine mixtures planned for human trials.

Reduced immunogenicity of DNA vaccine plasmids in mixtures.

We measured the ability of nine DNA vaccine plasmids encoding candidate malaria vaccine antigens to induce antibodies and interferon-gamma responses when delivered alone or in a mixture containing all nine plasmids. We further examined the possible immunosuppressive effect of individual plasmids, by assessing a series of mixtures in which each of the nine vaccine plasmids was replaced with a control plasmid. Given alone, each of the vaccine plasmids induced significant antibody titers and, in the four cases for which appropriate assays were available, IFN-gamma responses. Significant suppression or complete abrogation of responses were seen when the plasmids were pooled in a nine-plasmid cocktail and injected in a single site. Removal of single genes from the mixture frequently reduced the observed suppression. Boosting with recombinant poxvirus increased the antibody response in animals primed with either a single gene or the mixture, but, even after boosting, responses were higher in animals primed with single plasmids than in those primed with the nine-plasmid mixture. Boosting did not overcome the suppressive effect of mixing for IFN-gamma responses. Interactions between components in a multiplasmid DNA vaccine may limit the ability to use plasmid pools alone to induce responses against multiple targets simultaneously.

The infectivity of Plasmodium yoelii in different strains of mice.

We evaluated the effect of using Medium 199 alone and Medium 199 supplemented with 5% normal mouse serum, 5% fetal calf serum, 5% bovine serum albumin or 5% Albumax on Plasmodium yoelii sporozoite yield from infected mosquitoes and infectivity in BALB/c mice. The sporozoites yield, as well as their infectivity, was statistically lower (P = 0.0031) when unsupplemented Medium 199 was used to separate sporozoites from infected mosquitoes. Although Medium 199 supplemented with Albumax led to lower sporozoite yield (P < 0.0009), infectivity of the sporozoites was similar to those obtained with the other medium supplements. Because normal mouse serum supports good sporozoite infections and is also the supplement that can be used repeatedly in mice during multiple sporozoite injections without inducing anaphylaxis, we selected it to evaluate the infectivity of P. yoelii sporozoites in different strains of mice. After injecting mice with serial dilutions of sporozoites and detecting patent infections, we determined that the infective dose 50 (ID50) for BALB/c, C57Bl/6, A/J, and B10BR mice ranged between 4.9 and 10.6 sporozoites. The ID50 obtained for CD-1 mice (147 sporozoites) was significantly higher.

Immunogenicity and protective efficacy of a Plasmodium yoelii Hsp60 DNA vaccine in BALB/c mice.

The gene encoding the 60-kDa heat shock protein of Plasmodium yoelii (PyHsp60) was cloned into the VR1012 and VR1020 mammalian expression vectors. Groups of 10 BALB/c mice were immunized intramuscularly at 0, 3, and 9 weeks with 100 microg of PyHsp60 DNA vaccine alone or in combination with 30 microg of pmurGMCSF. Sera from immunized mice but not from vector control groups recognized P. yoelii sporozoites, liver stages, and infected erythrocytes in an indirect fluorescent antibody test. Two weeks after the last immunization, mice were challenged with 50 P. yoelii sporozoites. In one experiment the vaccine pPyHsp60-VR1012 used in combination with pmurGMCSF gave 40% protection (Fisher's exact test; P = 0.03, vaccinated versus control groups). In a second experiment this vaccine did not protect any of the immunized mice but induced a delay in the onset of parasitemia. In neither experiment was there any evidence of a protective effect against the asexual erythrocytic stage of the life cycle. In a third experiment mice were primed with PyHsp60 DNA, were boosted 2 weeks later with 2 x 10(3) irradiated P. yoelii sporozoites, and were challenged several weeks later. The presence of PyHsp60 in the immunization regimen did not lead to reduced blood-stage infection or development of parasites in hepatocytes. PyHsp60 DNA vaccines were immunogenic in BALB/c mice but did not consistently, completely protect against sporozoite challenge. The observation that in some of the PyHsp60 DNA vaccine-immunized mice there was protection against infection or a delay in the onset of parasitemia after sporozoite challenge deserves further evaluation.

Interleukin-12- and gamma interferon-dependent protection against malaria conferred by CpG oligodeoxynucleotide in mice.

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-gamma) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-gamma. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.

Plasmid vaccine expressing granulocyte-macrophage colony-stimulating factor attracts infiltrates including immature dendritic cells into injected muscles.

Plasmid-encoded GM-CSF (pGM-CSF) is an adjuvant for genetic vaccines; however, little is known about how pGM-CSF enhances immunogenicity. We now report that pGM-CSF injected into mouse muscle leads to a local infiltration of potential APCs. Infiltrates reached maximal size on days 3 to 5 after injection and appeared in several large discrete clusters within the muscle. Immunohistological studies in muscle sections from mice injected with pGM-CSF showed staining of cells with the macrophage markers CD11b, Mac-3, IA(d)/E(d) and to the granulocyte marker GR-1 from day 1 through day 14. Cells staining with the dendritic cell marker CD11c were detected only on days 3 to 5. Muscles injected with control plasmids did not stain for CD11c but did stain for CD11b, Mac-3, IA(d)/E(d), and GR-1. No staining was observed with the APC activation markers, B7.1 or CD40, or with markers for T or B cells. These findings are consistent with the infiltrating cells in the pGM-CSF-injected muscles being a mixture of neutrophils, macrophages, and immature dendritic cells and suggest that the i.m. APCs may be enhancing immune responses to coinjected plasmid Ags. This hypothesis is supported by data showing that 1) separation of injections with pGM-CSF and Ag-expressing plasmid into different sites did not enhance immune responses and 2) immune enhancement was associated with the presence of CD11c+ cells in the infiltrates. Thus, pGM-CSF enhancement may depend on APC recruitment to the i.m. site of injection.

Recombinant attenuated Toxoplasma gondii expressing the Plasmodium yoelii circumsporozoite protein provides highly effective priming for CD8+ T cell-dependent protective immunity against malaria.

The protozoan parasite Toxoplasma gondii elicits strong cell-mediated immunity against itself as well as nonspecific resistance against other pathogens and tumors. For this reason, we asked whether recombinant Toxoplasma could be utilized as an effective vaccine vehicle for inducing immunity against heterologous microbial infections. The circumsporozoite protein (PyCSP) of Plasmodium yoelii was engineered into a T. gondii temperature-sensitive strain (ts-4), a mutant that induces complete protection against virulent Toxoplasma challenge. When administered to mice in a single dose, a recombinant ts-4 (CSC3) that both secretes and expresses surface PyCSP induced strong anti-CSP Ab responses, with an isotype distribution pattern similar to that stimulated by the T. gondii carrier. When challenged with P. yoelii sporozoites during the first month after CSC3 vaccination, these animals displayed substantial levels of nonspecific resistance attributable entirely to the T. gondii carrier. Nevertheless, after the nonspecific protection had waned, high levels (up to 79%) of specific immunity against sporozoite challenge were achieved by boosting the animals with recombinant vaccinia virus expressing PyCSP. These CSC3-primed PyCSP-vaccinia-boosted mice displayed high frequencies of splenic PyCSP-specific IFN-gamma-producing cells, as well as CD8+ T cell-dependent cytolytic activity. In vivo depletion of CD8+ lymphocytes at the time of challenge completely ablated protective immunity in the T. gondii-primed/vaccinia-boosted animals, while neutralization of IFN-gamma or IL-12 caused a partial but significant reduction in resistance. Together these findings establish the efficacy of recombinant attenuated Toxoplasma as a vaccine vehicle for priming CD8+-dependent cell-mediated immunity.

Improving protective immunity induced by DNA-based immunization: priming with antigen and GM-CSF-encoding plasmid DNA and boosting with antigen-expressing recombinant poxvirus.

Intramuscular immunization with a naked DNA plasmid expressing the Plasmodium yoelii circumsporozoite protein (pPyCSP) protects mice against challenge with P. yoelii sporozoites. This protection can be improved either by coadministration of a plasmid expressing murine GM-CSF (pGMCSF) or by boosting with recombinant poxvirus expressing the PyCSP. We now report that combining these two strategies, by first mixing the priming dose of pPyCSP with pGMCSF and then boosting with recombinant virus, can substantially increase vaccine effectiveness. Not only were immune responses and protection improved but the pPyCSP dose could be lowered from 100 microg to 1 microg with little loss of immunogenicity after boost with recombinant poxvirus. Comparing mice primed by the 1-microg doses of pPyCSP plus 1 microg pGMCSF with mice primed by 1-microg doses of pPyCSP alone, the former were better protected (60% vs 0) and had higher concentrations of Abs (titers of 163, 840 vs 5, 120 by indirect fluorescent Ab test against sporozoites), more ex vivo CTL activity (25% vs 7% specific lysis), and more IFN-gamma-secreting cells by enzyme-linked immunospot assay (1460 vs 280 IFN-gamma spot-forming cells/106 cells). Priming with plasmid vaccine plus pGMCSF and boosting with recombinant poxviruses strongly improves the immunogenicity and protective efficacy of DNA vaccination and allows for significant reduction of dose.

Safety, tolerability and humoral immune responses after intramuscular administration of a malaria DNA vaccine to healthy adult volunteers.

DNA-based vaccines are considered to be potentially revolutionary due to their ease of production, low cost, long shelf life, lack of requirement for a cold chain and ability to induce good T-cell responses. Twenty healthy adult volunteers were enrolled in a Phase I safety and tolerability clinical study of a DNA vaccine encoding a malaria antigen. Volunteers received 3 intramuscular injections of one of four different dosages (20, 100, 500 and 2500 microg) of the Plasmodium falciparum circumsporozoite protein (PfCSP) plasmid DNA at monthly intervals and were followed for up to twelve months. Local reactogenicity and systemic symptoms were few and mild. There were no severe or serious adverse events, clinically significant biochemical or hematologic changes, or detectable anti-dsDNA antibodies. Despite induction of excellent CTL responses, intramuscular DNA vaccination via needle injection failed to induce detectable antigen-specific antibodies in any of the volunteers.

In vitro expression and in vivo immunogenicity of Plasmodium falciparum pre-erythrocytic stage DNA vaccines.

DNA vaccine plasmids were constructed that encoded four pre-erythrocytic antigens from the human malaria parasite Plasmodium falciparum: circumsporozoite protein (PfCSP); sporozoite surface protein 2 (PfSSP2); carboxyl terminus of liver stage antigen 1 (PfLSA-1 c-term); and, exported protein 1 (PfExp-1). Antigen expression was evaluated in vitro by immunoblot analysis of tissue culture cells following transient transfection with each plasmid. Clearly detectable levels of expression depended upon, or were markedly enhanced by, fusion of the antigen encoding sequences in-frame with the initiation complex and peptide leader sequence of human tissue plasminogen activator protein. Mice injected with these plasmids produced antigen specific antibody and cytotoxic T lymphocyte responses. However, the magnitudes of the responses were not always predicted by the in vitro expression assay. The results of this study provided the basis for further testing of these plasmids in primates and the formulation of multi-component pre-erythrocytic DNA vaccines for efficacy testing in human volunteers.

Induction of antigen-specific cytotoxic T lymphocytes in humans by a malaria DNA vaccine.

CD8+ cytotoxic T lymphocytes (CTLs) are critical for protection against intracellular pathogens but often have been difficult to induce by subunit vaccines in animals. DNA vaccines elicit protective CD8+ T cell responses. Malaria-naïve volunteers who were vaccinated with plasmid DNA encoding a malaria protein developed antigen-specific, genetically restricted, CD8+ T cell-dependent CTLs. Responses were directed against all 10 peptides tested and were restricted by six human lymphocyte antigen (HLA) class I alleles. This first demonstration in healthy naïve humans of the induction of CD8+ CTLs by DNA vaccines, including CTLs that were restricted by multiple HLA alleles in the same individual, provides a foundation for further human testing of this potentially revolutionary vaccine technology.

A plasmid encoding murine granulocyte-macrophage colony-stimulating factor increases protection conferred by a malaria DNA vaccine.

Using the murine parasite Plasmodium yoelii (Py) as a model for malaria vaccine development, we have previously shown that a DNA plasmid encoding the Py circumsporozoite protein (PyCSP) can protect mice against sporozoite infection. We now report that mixing a new plasmid PyCSP1012 with a plasmid encoding murine granulocyte-macrophage colony-stimulating factor (GM-CSF) increases protection against malaria, and we have characterized in detail the increased immune responses due to GM-CSF. PyCSP1012 plasmid alone protected 28% of mice, and protection increased to 58% when GM-CSF was added (p < 0.0001). GM-CSF plasmid alone did not protect, and control plasmid expressing inactive GM-CSF did not enhance protection. GM-CSF plasmid increased Abs to PyCSP of IgG1, IgG2a, and IgG2b isotypes, but not IgG3 or IgM. IFN-gamma responses of CD8+ T cells to the PyCSP 280-288 amino acid epitope increased but CTL activity did not change. The most dramatic changes after adding GM-CSF plasmid were increases in Ag-specific IL-2 production and CD4+ T cell proliferation. We hypothesize that GM-CSF may act on dendritic cells to enhance presentation of the PyCSP Ag, with enhanced IL-2 production and CD4+ T cell activation driving the increases in Abs and CD8+ T cell function. Recombinant GM-CSF is already used in humans for medical purposes, and GM-CSF protein or plasmids may be useful as enhancers of DNA vaccines.

Simultaneous induction of multiple antigen-specific cytotoxic T lymphocytes in nonhuman primates by immunization with a mixture of four Plasmodium falciparum DNA plasmids.

CD8(+) T cells have been implicated as critical effector cells in protective immunity against malaria parasites developing within hepatocytes. A vaccine that protects against malaria by inducing CD8(+) T cells will probably have to include multiple epitopes on the same protein or different proteins, because of parasite polymorphism and genetic restriction of T-cell responses. To determine if CD8(+) T-cell responses against multiple P. falciparum proteins can be induced in primates by immunization with plasmid DNA, rhesus monkeys were immunized intramuscularly with a mixture of DNA plasmids encoding four P. falciparum proteins or with individual plasmids. All six monkeys immunized with PfCSP DNA, seven of nine immunized with PfSSP2 DNA, and five of six immunized with PfExp-1 or PfLSA-1 DNA had detectable antigen-specific cytotoxic T lymphocytes (CTL) after in vitro restimulation of peripheral blood mononuclear cells. CTL activity was genetically restricted and dependent on CD8(+) T cells. By providing the first evidence for primates that immunization with a mixture of DNA plasmids induces CD8(+) T-cell responses against all the components of the mixture, these studies provide the foundation for multigene immunization of humans.

Boosting with recombinant vaccinia increases immunogenicity and protective efficacy of malaria DNA vaccine.

To enhance the efficacy of DNA malaria vaccines, we evaluated the effect on protection of immunizing with various combinations of DNA, recombinant vaccinia virus, and a synthetic peptide. Immunization of BALB/c mice with a plasmid expressing Plasmodium yoelii (Py) circumsporozoite protein (CSP) induces H-2Kd-restricted CD8+ cytotoxic T lymphocyte (CTL) responses and CD8+ T cell- and interferon (IFN)-gamma-dependent protection of mice against challenge with Py sporozoites. Immunization with a multiple antigenic peptide, including the only reported H-2Kd-restricted CD8+ T cell epitope on the PyCSP (PyCSP CTL multiple antigenic peptide) and immunization with recombinant vaccinia expressing the PyCSP induced CTL but only modest to minimal protection. Mice were immunized with PyCSP DNA, PyCSP CTL multiple antigenic peptide, or recombinant vaccinia expressing PyCSP, were boosted 9 wk later with the same immunogen or one of the others, and were challenged. Only mice immunized with DNA and boosted with vaccinia PyCSP (D-V) (11/16: 69%) or DNA (D-D) (7/16: 44%) had greater protection (P < 0. 0007) than controls. D-V mice had significantly higher individual levels of antibodies and class I-restricted CTL activity than did D-D mice; IFN-gamma production by ELIspot also was higher in D-V than in D-D mice. In a second experiment, three different groups of D-V mice each had higher levels of protection than did D-D mice, and IFN-gamma production was significantly greater in D-V than in D-D mice. The observation that priming with PyCSP DNA and boosting with vaccinia-PyCSP is more immunogenic and protective than immunizing with PyCSP DNA alone supports consideration of a similar sequential immunization approach in humans.

DNA vaccines for malaria: the past, the present, & the future.

The first clinical trial of a DNA vaccine designed to protect against malaria has just commenced. This vaccine has been designed to induce protective CD8+ T cell responses against Plasmodium falciparum infected hepatocytes. Herein, we review the rationale behind the development of vaccines that induce protective CD8+ T cells, the strategy for the development of a DNA vaccine designed to protect against falciparum malaria, and the experimental data in rodent models and nonhuman primates which has provided the foundation for trials of DNA vaccines against P. falciparum malaria in humans.